hw-03 | object-oriented programming, software engineering - spring'2008, dr. s. yurttas - solution
rationale
This is your last assignment to practice and show that you're able to maintain/adapt a given application using existing tools, i.e., command-line and/or visual studio 2005 with new functions.

You'll practice the fundamentals of programming using imperative language abstraction mechanisms in C++ to compose and structure an application using multiple functions and headers.

problem
You'll process the given data files as collected into one sequence and count the number of {A,C} in each and every sequence of all data files. 
      -> dna filenames : dna-filenames.txt

      [ input sequences -
        dna-00 :
        AAGTCTAGTACCC
        CAGAGTAGGACCT

        AAGTCTAGTACCCCAGAGTAGGACCT


        dna-01 :
        .
        .
        .
      ]

      [ dna-00 :
        A - 8
        C - 7

        .
        .
        .
      ]
  • For each set of given files: count and print the results.
  • Filename for the given datafiles read in, interactively, from command-line.
  • You'll do this repetitively until user decides as N, interactively, from the command-line.
  • Structuring and composition multiple functions in C++ will be the essence of grading, as well as correctness.
  • You will use and reuse C++ collections.
credit : 10 points due March 3 by 11pm.